Campylobacter jejuni - Isolamento de Gene e Ativação de Citotoxina

Isolation of a gene that is involved in Campylobacter jejuni 81116 cytotoxin activation Kaiyan Liu1 Benjamin N Fry2 Peter J Coloe2 1Landguard Development Facility Orica Australia Pty Ltd Bundoora Victoria Australia and 2Biotechnology and Environmental Biology School of Applied Sciences RMIT University Bundoora Victoria Australia Correspondence Peter J Coloe School of Applied Sciences Building 223 Level 1 Plenty Road Bundoora Victoria Australia 3083 Tel 61 3 99257104 fax 61 3 99257110 email pcoloermiteduau Received 16 January 2006 revised 21 June 2006 accepted 10 August 2006 First published online January 2007 DOI101111j1574695X200600183x Editor George Mendz Keywords Campylobacter jejuni cytotoxin cosmid library screen Abstract Cytotoxin fractions were isolated from Campylobacter jejuni 81116 and semipurified by sizeexclusion liquid chromatography The fraction showing the strongest toxicity was injected into mice to produce antiserum The antiserum was used to screen a C jejuni 81116 cosmid library Nine genes were identified in overlapping cosmid inserts that induced reactivity with the antiserum One of these genes showed high similarity to a periplasmic protein of unknown function and its isogenic mutant showed decreased toxicity compared to the C jejuni 81116 wild type This gene contains a Gramnegative bacterial RTX toxinactivating protein C signature which suggests it may play a role in C jejuni 81116 cytotoxin activation Introduction Campylobacter jejuni is now recognized as the most common bacterial cause of diarrhoea throughout the world and its infection is responsible for a major public health and economic burden Blaser et al 1983 Skirrow Blaser 1992 The pathophysiology of Campylobacter infections is not fully understood consequently this hinders the development of control mechanisms for Campylobacterinduced disease The potential virulence determinants of C jejuni are recognized to include adherence motility invasion and toxin production Fauchere et al 1992 Wassenaar 1997 One important factor in adherence is lipooligosaccharide LOS a major component of the Gramnegative outer membrane which also plays a role in serum resistance and endotoxicity McSween Walker 1986 van Vliet Ketley 2001 Infection by C jejuni leads to enterocolitis involving intestinal tissue damage which indicates that host cell invasion and perhaps cytotoxin production with subsequent tissue destruction are likely to be key elements in pathogenesis Ketley 1997 Toxin production by C jejuni has been reported by many research groups Wassenaar 1997 has proposed six different cytotoxins based on cell specificity Hanel et al 1998 suggested two different kinds of cytotoxins cytolethal distending toxin CDT and cytolethal rounding toxin CRT based on morphological changes of tissue cell lines However the characterisation of cytotoxin production by Campylobacter spp has been a slow progress So far there is no evidence on how many different cytotoxins C jejuni actually produces Hanel et al 1998 Except for CDT no other Campylobacter cytotoxins have been identified and sequenced As with other bacterial pathogens it is assumed that the toxin formation by C jejuni is complex involving a range of different toxins expressed under various as yet unknown conditions Misawa et al 1994 Wassenaar 1997 This may be a consequence of different research groups using different tissue culture cell lines for cytotoxin detection as well as different growth conditions for cytotoxin production In addition surface toxins such as LOS may also be implicated in cell cytotoxicity McSween Walker 1986 van Vliet Ketley 2001 It has been postulated that some strains of C jejuni produce cytotoxin Lee et al 2000 and so to help in understanding if there is a role for a discrete toxin in C jejuni pathogenesis the isolation and characterisation of specific toxinencoding genes is essential In mutagenesis studies on the C jejuni 81116 cdt gene we have found that this strain can produce toxic factors other than CDT unpublished data and so a C jejuni 81116 cosmid library was screened in a search for cytotoxins 2 encoding genes using specific antiserum raised against a C jejuni semipurified cytotoxic fraction prepared in this study Materials and methods Bacterial strains and culture conditions The bacterial strains and plasmids used in this work are listed in Table 1 Campylobacter jejuni was routinely grown under microaerophilic conditions 10 CO2 5 O2 in N2 on Columbia agar supplemented with 5 vv defibrinated horse blood and Campylobacter selective Skirrow Supplement for 48 h or in Brucella Broth for 96 h at 37 C Escherichia coli strains were grown in LuriaBertani LB broth or agar at 37 C overnight When necessary to maintain plasmid or mutant selection ampicillin was added to growth media at a final concentration of 100mg L1 tetracycline was added at a final concentration of 20mg L1 and kanamycin was added at a final concentration of 30mg L1 To minimize the in vitro passage C jejuni was stored at 70 C in milkfreezing medium before it was resuscitated on Skirrow medium and then subcultured in Brucella Broth Preparation of crude cytotoxin fraction For general toxicity testing C jejuni strains were inoculated in Brucella Broth at a starting OD600 nm of 0001 and were incubated at 37 C for 96 h A culture supernate fraction was prepared by centrifuging 10mL of bacterial culture at 14 000 g for 30min at 4 C The supernate was collected and passed through a 02μm filter A sonicated fraction was prepared by resuspending the cell pellet from 10mL of culture in 2mL 10mM TrisCl pH 80 buffer and sonicating at 70W for 30 s using a Branson digital sonifier 250 Danbury Cell debris was removed by centrifugation The supernate was collected and passed through a 02μm filter Semipurification of C jejuni 81116 cytotoxins Two litres of C jejuni culture were centrifuged at 14 000 g for 30min at 4 C and the supernatant was collected passed through a 02μm filter and concentrated 200fold using an ultrafilter equipped with a 50 kDa molecular weight cutoff membrane Amicon series 8000 Millipore The cytotoxic protein was purified with a selfpacked 16 40 cm Pharmacia C column with Sephacryl S200 size exclusion resin Amersham Pharmacia Sweden equipped with a Monitor UV1 Amersham Pharmacia Sweden One millilitre of concentrated sample was added to the column and eluted with 10mM TrisCl pH 80 at a flow rate of 1mL min1 Fractions were collected at 1 min intervals and pooled together based on the elution profile The pooled fractions were then concentrated 10fold by ultrafiltration and tested for cytotoxicity using the cytotoxin and MTT assay Cytotoxin and MTT assay Protein content was determined using the Bradford method Bradford 1976 Tissue culture cells were cultured in 25 cm2 tissue culture flasks Greiner Germany in Dulbeccos modification of Eagles Medium DMEM supplementing with 10 vv newborn bovine serum NBS and 5μg mL1 penicillinstreptomycin at 37 C in air with 5 CO2 until confluent Chinese hamster ovary CHO cells and human tumour epithelial HeLa cells were purchased from CSL Limited Melbourne Australia Human intestinal epithelial Int407 cells were supplied by Dr Peter Ward Royal Childrens Hospital Melbourne Australia Human larynx epidermoid carcinoma HEp2 cells were stock of the Biotechnology laboratory RMIT University Melbourne Australia Ninetysix well plates were seeded with 104 tissue culture cells in 100μL media and incubated overnight before cytotoxicity determination Cytotoxicity was quantified as previously described Coote Arain 1996 except that the plates were incubated at 37 C for 0 PARA QUINTA Escolher um artigo cientifico que aborde Tecnologia do DNA recombinante APONTE NO PAPER DNA de interesse O que codifica Enzima de restrição Vetor de clonagem Célula hospedeira Técnica de absorção do DNA YAC Plasmideo puc18 puc19 Cosmideo Fago lambda BAC 72 h Morphological changes were examined at 24 h intervals by phasecontrast microscopy Uninoculated Brucella Broth and sterile 10 mM TrisCl pH 80 were used as the negative controls After 72 h of incubation the percentage of cell death was determined using a MTT assay Coote Arain 1996 The plates were read at a wavelength of 600 nm using a Dynatech MR700 microplate reader Chantilly VA to determine the absorbance 100 microliters of 004 N HCl in dimethyl sulfoxide DMSO was used as a blank The percentage of cell death was calculated using the following equation cell death 1 OD600 nm of test well OD600 nm of negative control well x 100 The cytotoxicity was expressed as tissue culture dose 50 TCD50 A TCD50 was defined as the amount of the toxic fraction that caused death in 50 of the cells at the chosen timepoint Thelestam Florin 1994 Bacon et al 1999 Neutralization and Western blot analysis A selected fraction eluted from a size exclusion column with a protein concentration of 01 mg mL1 was detoxified by mixing with 05 vv formaldehyde solution pH 75 and incubating at 37 C overnight Female Balbc mice were used to raise polyclonal antiserum against this fraction Mice were administered 04 ml of pristane intraperitoneally and were stimulated intraperitoneally with 10 µg of detoxified cytotoxic fraction together with 100 µL of Incomplete Freunds adjuvant after 7 and 21 days followed by a third injection with 10 µg of the cytotoxic fraction and 100 µL of Incomplete Freunds adjuvant after 31 days At Day 41 mice were injected with 107 Sp2 cells Antiserum was collected from Day 51 to 53 For neutralization studies the selected fraction at a protein concentration of 1 mg mL1 was mixed with the specific antiserum at a 1 1 ratio vv and incubated at 37 C for 2 h before cytotoxicity determination The fraction mixed with sterilised 10 mM TrisCl pH 80 at a 1 1 ratio was incubated the same way and used as the control The antiserum was also analysed using Western blots according to Sambrook et al 1989 After electrophoretic transfer the nitrocellulose membrane was blocked by incubation with 5 wv skim milk in Tris saline and tween buffer for 1 h A one in 50 dilution of the antiserum was added to the membrane at 4 C overnight Goat antimouse horseradish peroxidaseconjugated HRP immunoglobulins were used to probe the membrane The bound peroxidase was visualised by incubating in 4 Chloro1naphthol solution for about 515 min in the dark Screening of the cosmid library by colony lift The cosmid library used in this study was constructed by Dr V Korolik with a cosmid vector pLA2917 ligated with Sau3AI partially cleaved C jejuni 81116 genome DNA fragments and transformed into E coli HB101 Fry et al 1998 The C jejuni 81116 cosmid library was screened using the colony lift method with E coli absorbed antiserum Sambrook et al 1989 The E coli HB101 carrying the vector pLA2917 and the C jejuni 81116 culture supernatant were used as the negative and positive controls respectively The experiment was repeated twice for consistency DNA manipulation All restriction endonucleases and T4 DNA ligase were purchased from Promega Australia and used according to the manufacturers instruction Plasmid and cosmid DNA was isolated from E coli using a modification of the alkaline lysis method Birnboim Doly 1979 Chromosomal DNA was isolated from pure cultures using the cetyltrimelthyl ammonium bromide CTAB procedure Sambrook et al 1989 Polymerase chain reaction The cosmids from selected clones were sequenced using the cosmid pLA2917 sequencing primers COS3 5ACAGCAAGCGAACCGGAATTG3 and COS4 5ATCATGCGAAACGATCCTCA3 Both primers were kindly provided by J Chang RMIT University Primers CJTP1 5GAAATTCAAGGTGGACGATGTATGGAT3 and CJTP2 5TTCTTAGGAAGCGTGATGT TAAAGC3 were designed based on the resulting C jejuni 81116 DNA sequence PCRs were performed using C jejuni 81116 genome DNA positive control pLA2917 negative control and the cosmids of the selected clones using the Expand Long Template PCR system Roche The PCR condition was 10 cycles of 10 s at 93 C 1 min at 60 C 7 min at 68 C 20 cycles of 10 s at 93 C 1 min at 60 C 7 min at 68 C with 20 s extra each cycle and a final extension step of 7 min at 68 C Central clone manager suite program was used for DNA sequences alignment translation restriction map construction and primer design The program Identify an unknown protein sequence provided by BioManager ANGIS httpbiomanagerangisorgau was used to identify proteins with unknown function Creation and analysis of knockout mutants The orf6 gene plus the orf7 gene were amplified together with the primers ORF6P6 5GCGGCGGATCCCATAAAGGAGTTATTATGAAA3 and ORF7P7 5CAGTAAGCTTGAAAATACCCGCTAATATACC3 restriction sites are indicated in bold The resulting PCR products were digested with HindIII and BamHI ligated with pBluescriptSKII digested by HindIII and BamHI and transformed into E coli DH5α The plasmid was named Orf67pB Inverse PCR was performed to delete part of orf6 using Orf67pB plasmid DNA and primer pairs ORF6IN1 5CAGTAGATCTCAGTAGGTAAGCCTAGTTGT3 and ORF6IN2 5CAGTAGATCTCCACCACTTTCTGAAATTCC3 The PCR conditions were 35 cycles of 30 s at 94 C 30 s at 58 C 9 min at 72 C and a final extension step of 10 min at 72 C with Pfu DNA polymerase Promega Australia After inverse PCR digestion with BglII and selfligation plasmid Orf67pBIN was obtained containing a unique BglII site in orf6 This site was then used for inserting a kanamycin resistance cassette originating from plasmid pMW2 containing the BamHI end to create plasmid Orf6pBKF The orientation of the kanamycin resistance cassette was determined by digesting the mutation constructs with restriction enzyme ClaI Natural transformation was used to introduce the constructs in C jejuni 81116 as described previously Wassenaar et al 1993 The resulting mutants were confirmed using PCR and restriction digestions Results and Discussion Semipurification of C jejuni cytotoxins Sizeexclusion lowpressure chromatography was used to separate the C jejuni 81116 culture supernatant based on molecular weight The column of a 30mL void volume allowed the semipurified toxin preparation to be separated into 7 10 mL fractions All fractions were tested in a cytotoxin assay and the fraction Fraction A collected between retention time 50 and 60 min caused a strong rounding effect on CHO cells Fig 1b Fraction A was used as a semipurified sample to inject into mice for antiserum production Western blot and neutralisation study To test the antiserum raised against Fraction A the protein fraction was separated by SDSPAGE and subjected to Western blot analysis After incubating with the antiserum four bands with sizes of 45 33 24 and 20 kDa were recognized by the antiserum Fig 2b After incubating Fraction A with the antiserum at 37 C for 2 h its cytotoxicity decreased 92 Fig 2a This indicated that this antiserum could react with the toxic factors in Fraction A Screening of the cosmid library by colony lift The antiserum was then used to screen the C jejuni 81116 cosmid library using the colony lift method with a positive and a negative control The following eight clones produced a positive reaction 1C12 1F12 3C5 6A8 6A9 6A10 6A11 and 6A12 Fig 1 a Size exclusion liquid chromatography elution profile of the C jejuni 81116 concentrated culture supernatant a indicates the fraction collected according to the elution time and caused a strong rounding effect on CHO cells b c Normal CHO cells Fig 2 a Specific cytotoxicity of C jejuni 81116 culture supernatant Fraction A before and after neutralisation by the antiserum raised against Fraction A b SDSPAGE analysis of the C jejuni 81116 culture supernatant fractions visualized with Western blot probed with antiserum raised against Fraction A Lane 1 SeeBlue Plus2 PreStained Protein Standard Invitrogen Australia Lane 2 Fraction A 30 µg protein content of Fraction A was loaded on the gel Genetic analysis of the positive clones Restriction enzyme digestion The positive cosmids and pLA2917 were isolated and digested with HindIII EcoRV and BglII The patterns of these restriction digestion maps revealed by agarose gel electrophoresis showed that there were only four discrete clones Fig 3 The clones 6A8 6A9 6A10 6A11 and 6A12 were the same as was shown in all three patterns These three digestion patterns also showed that there were differences between 1C12 and 3C5 although they shared a large overlapping fragment DNA sequencing and analysis The cosmid DNA of the clones 1F12 3C5 and 6A9 were subjected to sequencing About 1000 bps from both ends of the inserted fragments were sequenced and aligned with the C jejuni NCTC 11168 genome DNA sequence accession no AL139074 The most likely overlap was identified to range from the position 14 383 to the position 22 801 on the C jejuni NCTC 11168 genome DNA sequence PCR sequencing and ORF analysis Using primers CTP1 and CTP2 PCR amplicons obtained from the C jejuni 81116 genome DNA and the clones 1C12 1F12 3C5 6A8 6A9 6A10 6A11 and 6A12 had a similar size No amplicon was obtained from pLA2917 This confirmed that all the clones had the overlapping sequence The DNA sequence of the entire overlapping fragment was obtained GenBank accession no DQ202384 and showed 97 identity to the C jejuni NCTC 11168 DNA sequence The overlapping fragment contained eight complete ORFs and one partial ORF Their predicted functions are outlined in Table 2 A conserved domain search showed that Orf1 and Orf5 had putative functions that were responsible for amino acid or carbohydrate transport and metabolism Orf2 and Orf3 might function in DNA replication recombination and repair Orf4 showed high similarity to rubrerythrin which is responsible for energy production and conversion and was suggested as an oxidative stressresponsive protein in C jejuni Orf8 was predicted to code for a transcriptional regulatory protein It also showed 995 similarity to the PPloop superfamily ATPases Apart from the orf6 and orf7 genes the other six genes were involved in the amino acid and carbohydrate transport and metabolism DNA replication recombination repair energy production and conversion No correlation between these functions and cytotoxin production has been found todate Orf7 seems to be a bifunctional protein Its Nterminal region showed high similarity to a competence protein responsible for intracellular trafficking and secretion and the Cterminal region showed high similarity to a predicted hydrolase of a HD superfamily These seven genes are considered to be housekeeping genes and hence most likely do not play a role in C jejuni pathogenesis Similarity searches could not predict a function for Orf 6 which was only suggested as an inner membrane protein A conserved domain search indicated that Orf6 was highly similar to a periplasmic or secreted protein with unknown function Although these proteins are conserved and exist in a wide range of bacteria such as E coli Staphylococcus aureus Actinobacillus pleuropneumoniae and Pseudomonas syringae their function has not been elucidated Fig 3 Cosmids of the selected clones digested by BglII a EcoRV b and HindIII c Lane 1 λDNA PstI Lane 210 pLA2917 cosmids of 1C12 1F12 3C5 6A8 6A9 6A10 6A11 and 6A12 Table 2 Predicted functions of the ORFs ORF Amino Acids MW pI Function Orf1 481 53 08230 896 Glutamate synthase NADPH small subunit gltD Orf2 159 17 94424 955 Ribonuclease HII rnhB Orf3 79 885248 944 Putative nonspecific DNA binding protein Cj0011c Orf4 215 24 51185 549 Nonhaem iron protein Cj0012c Orf5 495 50 48073 882 Dihydroxyacid dehydratase ilvD Orf6 174 20 41623 652 Putative integral membrane protein Cj0014c Orf7 408 47 40661 548 Hypothetical protein Cj0015c Orf8 224 25 23707 513 Putative transcriptional regulatory protein Cj0016 Orf9 139 15 41558 947 Putative ATPGTP binding protein Incomplete Adapted from the C jejuni NCTC 11168 protein list httpwwwncbinlmnihgoventrezqueryfcgicmdRetrievedbgenomedoptProtein Tablelistuids152 When using the Identify an unknown protein program Orf6 was found to contain a Block similar to PR01489 RTXTOXINC which is a fourelement fingerprint that provides a signature for the Gramnegative bacterial RTX toxinactivating protein C family Blocks are multiply aligned ungapped segments corresponding to the most highly conserved regions of proteins Henikoff Henikoff 1994 The fingerprint PR01489 was derived from an initial alignment of four sequences the motifs were drawn from conserved regions spanning virtually the full alignment length 150 amino acids Motif 1 contains the putative active site histidine Coote 1992 Trent et al 1999 Orf6 was found to contain one block similar to this motif at the Cterminal end The RTX repeats in toxin toxin family includes structurally and functionally related poreforming cytolysins produced by Gramnegative bacteria They require Ca2 for activity and are synthesised as inactive proteins Coote 1992 Czuprynski Welch 1995 A typical RTXtoxin operon contains four structural genes which exist in the order rtxCABD The RtxA protein is the structural component of the exotoxin whereas RtxB and D are required for extracellular secretion of the toxin RtxC is an acylcarrierproteindependent acylmodification enzyme which is responsible for posttranslational activation of RtxA to form an active toxin Ludwig 1996 Lally et al 1999 The most extensively studied RTXtoxin is the αhaemolysin from E coli Studies showed that Protein C of the haemolysin is an internal protein acyltransferase which catalyses the transfer of a fattyacyl group from acylACP to Ramino groups of lysine residues 564 and 690 of prohaemolysin Protein A and converts it to an active toxin Goebel Hedgpeth 1982 Ludwig et al 1996 Trent et al 1998 The Blocksearcher results also showed that Orf6 had two blocks similar to UbiA prenyltransferase but with a high E value These results might indicate that the Orf6 is a transferase and is involved in toxin activation However the similarity between the blocks of Orf6 and RtxC is very low and Orf6 does not seem to locate in an operon that contains structural toxin genes To determine whether orf6 is involved in C jejuni cytotoxin production this gene was chosen for mutagenesis studies Cytotoxicity of knockout mutant The C jejuni 81116 wild type and the orf6 mutant were cultured for 96 h at 37C in Brucella Broth Their culture Fig 4 Cytotoxin production of the C jejuni 81116 wild type and the orf6 isogenic mutant Cytotoxicity was determined using different cell lines Specific cytotoxicity was calculated by combining the culture supernatant and sonicated culture supernatant fractions Orf6KF the C jejuni 81116 orf6 mutant with the kanamycin resistance cassette in the forward orientation Cytotoxicity values shown in the figure are average values from three individual samples Error bars indicate SD supernatant and sonicated culture supernatant fractions were filter sterilized and their cytotoxicity was determined The Orf6 isogenic mutant showed significant loss in specific toxicity on CHO HeLa HEp2 and Int407 cells compared to the wild type Fig 4 Inactivation of Orf6 had a greater effect on HeLa cell cytotoxicity in comparison to the other cell lines used in this study The loss of activity was mainly in the sonicated culture supernatant which showed about 70 decrease in toxicity It indicated that either the protein Orf6 is a toxin and binds very strongly to the cell pellets or C jejuni 81116 has a toxic factor that binds very strongly to the cell pellet and needs Orf6 to express activity The results of the mutagenesis experiments described in this paper showed that the orf6 gene was involved in C jejuni 81116 toxin production As it contains a Gramnegative RTX toxinactivating protein C signature it is possible that the Orf6 protein only contributes in C jejuni cytotoxin activation rather than being an active toxin itself Further studies need to be conducted to find out its role in C jejuni cytotoxicity References Bacon DJ Johnson WM Rodgers FG 1999 Identification and characterisation of a cytotoxic porinlipopolysaccharide complex from Campylobacter jejuni J Med Microbiol 48 139148 Birnbimom HC Doly JA 1979 A rapid alkaline extraction procedure for screening recombinant plasmid DNA Nucleic Acids Res 7 15131523 Blaser MJ Taylor DN Feldman RA 1983 Epidemiology of Campylobacter jejuni infections Epidemiol Rev 5 157176 Boyer HW RoullandDussoix D 1969 A complementation analysis of the restriction and modification of DNA in Escherichia coli J Mol Biol 41 459472 Bradford MM 1976 A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of proteindye binding Anal Biochem 72 248254 Coote JG 1992 Structural and functional relationships among the RTX toxin determinants of gramnegative bacteria FEMS Microbiol Rev 8 137161 Coote JG Arain T 1996 A rapid colourimetric assay for cytotoxin activity in Campylobacter jejuni FEMS Immunol Med Microbiol 13 6570 Czuprynski CJ Welch RA 1995 Biological effects of RTX toxins the possible role of lipopolysaccharide Trends Microbiol 3 480483 Ditta G Stanfield S Corbin D Helinski DR 1980 Broad host range DNA cloning system for Gramnegative bacteria construction of a gene bank of Rhizobium meliloti Proc Natl Acad Sci USA 77 73477351 Fauchere JL Kervella M Rosenau A Pages JM Fendri C 1992 In vitro study of virulence factors of enteric Campylobacter spp Campylobacter jejuni current status and future trends Nachamkin I Blaser MJ Tompkins LS eds pp 168175 American Society for Microbiology Washington DC Fry BN Korolik V ten Brinke JA Pennings MT Zalm R Teunis BJ Coloe PJ van der Zeijst BA 1998 The lipopolysaccharide biosynthesis locus of Campylobacter jejuni 81116 Microbiology 144 20492061 Goebel W Hedgpeth J 1982 Cloning and functional characterization of the plasmidencoded hemolysin determinant of Escherichia coli J Bacteriol 151 12901298 Hanahan D 1983 Studies on transformation of Escherichia coli with plasmids J Mol Biol 166 557580 Hanel I Schulze F Hotzel H Schubert E 1998 Detection and characterization of two cytotoxins produced by Campylobacter jejuni strains Zentbl Bakteriol 288 131143 Henikoff S Henikoff JG 1994 Protein family classification based on searching a database of blocks Genomics 19 97107 Ketley JM 1997 Pathogenesis of enteric infection by Campylobacter Microbiology 143 521 Lally ET Hill RB Kieba IR Korostoff J 1999 The interaction between RTX toxins and target cells Trends Microbiol 7 356361 Lee A Smith SC Coloe PJ 2000 Detection of a novel campylobacter cytotoxin J Appl Microbiol 89 719725 Ludwig A 1996 Cytolytic toxins from gramnegative bacteria Microbiologia 12 281296 Ludwig A Garcia F Bauer S Jarchau T Benz R Hoppe J Goebel W 1996 Analysis of the in vivo activation of hemolysin HlyA from Escherichia coli J Bacteriol 178 54225430 McSweegan E Walker RI 1986 Identification and characterisation of two Campylobacter jejuni adhesins for cellular and mucous substrates Infect Immun 53 141148 Misawa N Ohnishi T Itoh K Takahashi E 1994 Development of a tissue culture assay system for Campylobacter jejuni cytotoxin and the influence of culture conditions on cytotoxin production J Med Microbiol 41 224230 Palmer SR Gully PR 1983 Waterborne outbreak of campylobacter gastroenteritis Lancet i 287290 Sambrook J Fritsch EF Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbour Laboratory Press Cold Spring Harbour NY Skirrow MB Blaser MJ 1992 Clinical and epidemiologic considerations Campylobacter jejuni current status and future trends Nachamkin I Blaser MJ Tompkins LS eds pp 18 American Society for Microbiology Washington DC Thelestam M Florin I 1994 Assay of cytopathogenic toxins in cultured cells Methods Enzymol 235 679689 Trent MS Worsham LM ErnstFonberg ML 1998 The biochemistry of hemolysin toxin activation characterization of HlyC an internal protein acyltransferase Biochemistry 37 46444652 Trent MS Worsham LM ErnstFonberg ML 1999 HlyC the internal protein acyltransferase that activates hemolysin toxin role of conserved histidine serine and cysteine residues in enzymatic activity as probed by chemical modification and sitedirected mutagenesis Biochemistry 38 34333439 van Vliet AHM Ketley JM 2001 Pathogenesis of enteric Campylobacter infection J Appl Microbiol 90 45S56S Wassenaar TM 1997 Toxin production by Campylobacter spp Clin Microbiol Rev 10 466476 Wassenaar TM Fry BN Zeijst BAVD 1993 Genetic manipulation of Campylobacter evaluation of natural transformation and electrotransformation Gene 132 131135 cytotoxin and the influence of culture conditions on cytotoxin production J Med Microbiol 41 224230 Palmer SR Gully PR 1983 Waterborne outbreak of campylobacter gastroenteritis Lancet i 287290 Sambrook J Fritsch EF Maniatis T 1989 Molecular Cloning A Laboratory Manual Cold Spring Harbour Laboratory Press Cold Spring Harbour NY Skirrow MB Blaser MJ 1992 Clinical and epidemiologic considerations Campylobacter jejuni current status and future trends Nachamkin I Blaser MJ Tompkins LS eds pp 18 American Society for Microbiology Washington DC Thelestam M Florin I 1994 Assay of cytopathogenic toxins in cultured cells Methods Enzymol 235 679689 Trent MS Worsham LM ErnstFonberg ML 1998 The biochemistry of hemolysin toxin activation characterization of HlyC an internal protein acyltransferase Biochemistry 37 46444652 Trent MS Worsham LM ErnstFonberg ML 1999 HlyC the internal protein acyltransferase that activates hemolysin toxin role of conserved histidine serine and cysteine residues in enzymatic activity as probed by chemical modification and sitedirected mutagenesis Biochemistry 38 34333439 van Vliet AHM Ketley JM 2001 Pathogenesis of enteric Campylobacter infection J Appl Microbiol 90 45S56S Wassenaar TM 1997 Toxin production by Campylobacter spp Clin Microbiol Rev 10 466476 Wassenaar TM Fry BN Zeijst BAVD 1993 Genetic manipulation of Campylobacter evaluation of natural transformation and electrotransformation Gene 132 131135 Artigo Isolation of a gene that is involved in Campylobacter jejuni 81116 cytotoxin activation DNA de interesse o que codifica Nesse estudo todo o genoma da bactéria Campylobacter jejuni linhagem 81116 foi utilizado para a construção de uma biblioteca de cosmídeos com a finalidade de encontrar proteínas envolvidas na citotoxicidade causada por essa espécie de bactéria Enzima de restrição A enzima de restrição utilizada pelos autores foi a Sau3AI Vetor de Clonagem O vetor de clonagem utilizado foi o cosmídeo pLA2917 Célula hospedeira As células utilizadas para hospedar o DNA recombinante no estudo foram da linhagem HB101 da bactéria Escherichia coli Técnica de absorção do DNA O DNA de cosmídeo foi inserido nas células hospedeiras através do método de transformação Referência Bibliográfica LIU Kaiyan FRY Benjamin N COLOE Peter J Isolation of a gene that is involved in Campylobacter jejuni 81116 cytotoxin activation Fems Immunology Medical Microbiology v 49 n 1 p 133140 fev 2007